Promega Corporation

pTargeT™ Sequencing Primer

The pTargeT™ Sequencing Primer is designed for sequencing inserts cloned into the pTargeT™ Mammalian Expression Vector (Cat.# A1410). The sequencing primer hybridizes to the region of the lacZ gene at nucleotides 1367–1344 on the pTargeT™ Vector.

The primer can be used only for sequencing inserts cloned into the pTargeT™ Vector. The primer sequence is not a binding site for any RNA polymerases and cannot be used to generate in vitro transcripts.

The sequence of the pTargeT™ Sequencing Primer is 5´-d(TTACGCCAAGTTATTTAGGTGACA)-3´.

The primer is supplied at a concentra...

Expand to Read More »

  • Share
  • Print
  • Email
  • Prices valid for Canada customers only
Product Size Conc. Catalog # *List Price Order QTY Add to Cart

pTargeT™ Sequencing Primer

Close Window

pTargeT™ Sequencing Primer

 Components

  • pTargeT™ Sequencing Primer (24mer)

    Q446A1 x 2μg
Close Window
  • This product can be added to a

  • Helix Freezer

This product is available through the Promega Helix onsite stocking program in a –20°C Helix Freezer. The program offers numerous convenient solutions to meet your lab's needs. Helix Freezers are available in two sizes: 5.7 cubic ft. or 9.7 cubic ft.


Click here to learn more about the Helix Collection »


Already a Helix Customer?

Request to add this product to your Helix »


2μg
- Q4461 C$ 84.00 Add to cart


You Also May Be Interested In

Storage Conditions

Store at –20°C.

For product intended use please see Patents & Disclaimers tab.

Use Restrictions

Q4461 For Research Use Only. Not for Use in Diagnostic Procedures.

It appears that you have Javascript disabled. Our website requires Javascript to function correctly. For the best browsing experience, please enable Javascript.

Scientists at Your Service

Scientists at Your Service

We offer a range of services to help you succeed using Promega technologies. From product training to set up of automated systems and development of custom applications—our scientific support goes beyond the basics.

Ask us! We are here to help you.