Promega Corporation

Plexor® Real-Time PCR Assay for the Detection and Quantitation of an Animal Virus,...

Plexor® Real-Time PCR Assay for the Detection and Quantitation of an Animal Virus, Porcine Circovirus Type 2

SEARCH ARTICLES

LabFact #40

For PCR cloning, purify the desired PCR product away from nonspecific products, especially primer dimers because they ligate efficiently, generating many white colonies that appear to contain no insert.

  • Share
  • Print
  • Email
  • Download PDF
  • Article
  • Figures & Tables
  • Comments & Ratings

Abstract

The Plexor® qPCR System was used to detect and quantitate an animal virus for the first time. We tested the assay for sensitivity, specificity and reproducibility, and compared the Plexor® technology to three other real-time PCR formats.

Michaela Vlasakova, Anna Jackova and Stefan Vilcek

University of Veterinary Medicine and Pharmacy, Kosice, Slovakia

Introduction

Several quantitative PCR (qPCR) systems for the detection and amplification of nucleic acids have been developed. The most frequently used real-time PCR assays employ TaqMan® probes and SYBR® Green intercalating dye. Other amplification systems use Light Upon eXtension (LUX) primers, molecular beacons or scorpion primers for example.

A novel real-time PCR approach based on the Plexor® technology was introduced a few years ago. The Plexor® technology uses an interaction between two modified molecules: a dabcyl-iso-dGTP nucleotide and an iso-C (5´‑methylisocytosine) residue of a fluorescently labeled primer. Since proximity of the dabcyl quencher and fluorophore leads to quenching of the fluorescent signal during each amplification cycle, the Plexor® technology can be used for quantitative real-time PCR (1) .

The Plexor® technology has been used to detect an animal parasite (2) but has not yet been applied to detection and quantitation of animal viruses. Therefore, the aim of our study was to develop Plexor® real-time PCR to detect and quantitate porcine circovirus type 2 (PCV2), which is an etiological agent of postweaning multisystemic wasting syndrome (PMWS) in pigs (3) .

Methods and Results

A recombinant pBluescript® SK+ plasmid carrying the entire PCV2 genome was used as a template. The Plexor® qPCR System (Cat.# A4031) was used for in vitro amplification. Experiments were performed on the MiniOpticon™ Two-Color Real-Time PCR Detection System (Bio-Rad, Inc.). Data export from the Opticon™ Monitor Analysis Software, data import into the Plexor® Analysis Software and data analysis were all performed according to the instructions listed in the Plexor™ Systems Instrument Setup and Data Analysis for the DNA Engine Opticon® 2 Real-Time PCR Detection System Technical Manual #TM271.

Selection of primers and optimization of their concentration

The primers PX1 (5´-CGAAGACGAGCGCAAGAAA) and PX2R (5´-FAM-iso-dC- TCGTCCTTCCTCATTACCCTCC) flanking an 88bp DNA fragment were selected from the PCV2 genome using the computer program Plexor® Primer Design System, Version 1.2. Of several pairs of primers selected by the program, the above-mentioned primer pair was chosen based on the evolutionary conserved open reading frame (ORF) 1 regions in the alignment of 30 PCV2 genome sequences acquired from GenBank®. Reactions were set up as directed in the Plexor® qPCR System Technical Manual #TM262 by combining 12.5µl of 2X Plexor® Master Mix, 1µl of each 5µM primer and nuclease-free water (Serva Electrophoresis GmbH, Germany) to reach a final volume of 20µl. The primer concentration was 100–400nM in the final reaction volume. PCV2 DNA was diluted tenfold, and 5µl was added to give final amounts of 108 to 102 copies of DNA per reaction. After initial denaturation at 95°C for 2 minutes, a two-step amplification followed: 95°C for 5 seconds and 60°C for 35 seconds.

Our experiments demonstrated that the ideal slope of the amplification curves was achieved with 200nM to 400nM of both primers. We concluded that 200nM of each primer concentration was optimal for detecting PCV2 DNA by Plexor® real-time PCR, and used this concentration in further experiments.

Sensitivity, specificity and reproducibility of the Plexor® real-time PCR assay

To determine the sensitivity of the novel real-time PCR assay, we varied the template amount between
108–101 copies of PCV2 DNA per reaction. The Ct values varied between 11.2 (108 copies of DNA) to 34.1 (101 copies of template; Figure 1, Panel A), confirming that the assay could detect at least 10 viral copies/reaction. Practically ideal values of slope (y = –3.34) and regression coefficient (R2 = 0.998) indicated a linear correlation, the standard curve with an amplification efficiency of 99.41% (Figure 1, Panel B). Plexor® technology distinguishes nonspecific PCR products by performing a melting curve analysis. We tested the utility of the melt curve analysis by amplifying four other viruses that infect pigs (PRRSV, CSFV, TTV and PCV1). In all samples containing PCV2 DNA, only the specific peak was observed (Figure 1, Panel C). No amplification or nonspecific peaks were detected when other viral DNAs were analyzed (data not shown). The intra- and interassay variation of the Plexor® real-time PCR assay results was lower than 2.2%, indicating excellent reproducibility of the test.

Real-time PCR analysis of PCV2 DNA.Figure 1. Real-time PCR analysis of PCV2 DNA.

Panel A. Amplification curves of PCV2 DNA concentrations varying between 108 and 101 copies. Panel B. Standard curve based on Ct values of tenfold dilutions of template DNA. Panel C. Melt curve analysis of PCR products.

Panel A. Amplification curves of PCV2 DNA concentrations varying between 108 and 101 copies. Panel B. Standard curve based on Ct values of tenfold dilutions of template DNA. Panel C. Melt curve analysis of PCR products.

/~/media/images/resources/figures/pubhub ext auth figs/tpub039_fig1.jpg?la=en

Comparison of the Plexor® real-time PCR assay to the other qPCR systems

To evaluate the amplification curves, Ct values and other important parameters, we compared the Plexor® real-time PCR assay to three other real-time PCR systems used to detect and quantify PCV2. Tenfold dilutions of recombinant plasmid DNA with the PCV2 genome (107–102 copies/reaction) were amplified using Plexor®, SYBR® Green, TaqMan® and LUX real-time PCR assays recently developed in our laboratory (4) . The slope of amplification and standard curves were slightly different for each real-time PCR system (Figure 2). This phenomenon can be explained by the different chemistries of each real-time PCR assay, which leads to different Ct values obtained with the same concentration of template (Table 1). We observed the Plexor® and SYBR® Green assays had the most ideal slope, regression coefficient and amplification efficiency and the lowest Ct values.

Standard curves constructed during amplification of PCV2 DNA using four different real-time PCR systems.Figure 2. Standard curves constructed during amplification of PCV2 DNA using four different real-time PCR systems.

Table 1. Comparison of Ct Values Obtained During PCV2 Template Amplification Employing Four Different Real-Time PCR Systems.
DNA Amount (copies/reaction) SYBR® Green (Ct) Plexor® (Ct) TaqMan® (Ct) LUX (Ct)
2.0 × 107 12.0 13.9 15.7 16.7
2.0 × 105 19.0 19.9 24.5 24.4
2.0 × 102 29.4 32.3 34.8 34.1

Conclusions

Real-time PCR based on the Plexor® technology was used for the first time to detect and quantify a virus (PCV2) of veterinary importance. Nearly ideal values of slope and regression coefficient for the standard curve suggested that amplification of viral DNA using this novel technology was efficient. Sensitivity, specificity and high reproducibility of the assay were comparable to or better than other real-time PCR platforms. Although data analysis is based on the opposite principle to other real-time PCR systems (i.e., signal decreases unlike most other real-time PCR assays), Plexor® Analysis Software is user-friendly and allows easy interpretation of experimental data. The Plexor® real-time PCR assay proved to be an excellent method for detecting and quantitating PCV2.

Acknowledgments

This work was supported by project INFEKTZOON – Center of excellence for infectious diseases and zoonoses financed by EU. We would like to acknowledge Promega Corporation for providing the Plexor® qPCR System (Cat.# A4031) and Promega Technical Services for support.

References

  1. Frackman, S. et al. (2005) Plexor® technology: A new chemistry for real-time PCR Promega Notes 90, 2–4.
  2. Ghalmi, F. et al. (2008) Detection of Neospora caninum in dog organs using real-time PCR systems. Vet. Parasitol. 155, 161–7.
  3. Allan, G.M. et al. (1998) Isolation of porcine circovirus-like viruses from pigs with a wasting disease in the USA and Europe. J. Vet. Diagn. Invest. 10, 3–10.
  4. Vilcek, S., Vlasakova, M. and Jackova, A. (2010) LUX real-time PCR assay for the detection of porcine circovirus type 2. J. Virol. Methods. 165, 216–21.

How to Cite This Article

Vlasakova M, Jackova A and Vilcek S. Plexor Real-Time PCR Assay for the Detection Quantitation of an Animal Virus PCV Type 2. [Internet] . [cited: year, month, date]. Available from: http://www.promega.ca/resources/articles/pubhub/plexor-real-time-pcr-assay-for-the-detection-quantitation-of-an-animal-virus-pcv2/

Vlasakova M, Jackova A and Vilcek S. Plexor Real-Time PCR Assay for the Detection Quantitation of an Animal Virus PCV Type 2. Promega Corporation Web site. http://www.promega.ca/resources/articles/pubhub/plexor-real-time-pcr-assay-for-the-detection-quantitation-of-an-animal-virus-pcv2/ Accessed Month Day, Year.

Plexor is a registered trademark of Promega Corporation.

GenBank is a registered trademark of US Dept of Health and Human Services. MiniOpticon and Opticon are trademarks of Bio-Rad Laboratories, Inc. pBluescript is a registered trademark of Strategene. SYBR is a registered trademark of Molecular Probes, Inc. TaqMan is a registered trademark of Roche Molecular Systems, Inc.

Figures

Real-time PCR analysis of PCV2 DNA.Figure 1. Real-time PCR analysis of PCV2 DNA.

Panel A. Amplification curves of PCV2 DNA concentrations varying between 108 and 101 copies. Panel B. Standard curve based on Ct values of tenfold dilutions of template DNA. Panel C. Melt curve analysis of PCR products.

Panel A. Amplification curves of PCV2 DNA concentrations varying between 108 and 101 copies. Panel B. Standard curve based on Ct values of tenfold dilutions of template DNA. Panel C. Melt curve analysis of PCR products.

/~/media/images/resources/figures/pubhub ext auth figs/tpub039_fig1.jpg?la=en
Standard curves constructed during amplification of PCV2 DNA using four different real-time PCR systems.Figure 2. Standard curves constructed during amplification of PCV2 DNA using four different real-time PCR systems.
  • Warning
  • It appears that you have Javascript disabled. Our website requires Javascript to function correctly. Please enable Javascript to experience our website.

Scientists at Your Service

We offer a range of services to help you succeed using Promega technologies. From product training to set up of automated systems and development of custom applications—our scientific support goes beyond the basics.

Ask us! We are here to help you.

Click Here for Technical Questions and Ordering Support »