pUC/M13 Sequencing Primers
Designed for Sequencing Inserts Cloned into the M13 Vectors and pUC Plasmids
- Sequence other lacZ-containing plasmids such as the pGEM®-Z and pGEM®-Zf Vectors
- Supplied at a concentration of 10μg/ml
- pUC/M13 Primer, Forward (17mer; Cat.# Q5391), is no longer available
- pUC/M13 Primer, Reverse (22mer; Cat.# Q5421), is no longer available
Catalog Number:
Choose a primer length and direction
Size
Catalog Number: Q5401
Catalog Number: Q5601
The pUC/M13 Primers are used to sequence inserts cloned into the M13 vectors and pUC plasmids developed by Messing. The primers are purified by gel electrophoresis or HPLC and supplied in sterile water.
Primer Sequences
- Reverse (17mer): 5´-d(CAGGAAACAGCTATGAC)-3´
- Forward (24mer): 5´-d(CGCCAGGGTTTTCCCAGTCACGAC)-3´
Reference
- Messing, J. (1983) Meth. Enzymol. 101, 20–78.
Protocols
No protocols available
Specifications
Catalog Number:
What's in the box
| Item | Part # | Choose a size |
|---|---|---|
|
pUC/M13 Primer, Reverse (17mer) |
Q540A | 1 × 2μg |
SDS
Search for SDSCertificate of Analysis
Use Restrictions
For Research Use Only. Not for Use in Diagnostic Procedures.Storage Conditions
What's in the box
| Item | Part # | Choose a size |
|---|---|---|
|
pUC/M13 Primer, Forward (24mer) |
Q560A | 1 × 2μg |
SDS
Search for SDSCertificate of Analysis
Use Restrictions
For Research Use Only. Not for Use in Diagnostic Procedures.Storage Conditions
Resources
No related resources available
Related Products
Frequently Used With
pGEM®-T Vector Systems
T-vector for simplified cloning of PCR products.
A3600, A3610
pGEM®-T Easy Vector Systems
PCR cloning vectors with 3 options for insert excision.
A1360, A1380
pGEM-3Zf(+/–) Vectors
Standard cloning vectors that can produce ssDNA and in vitro transcribe sense and antisense RNA; offers blue/white screening.
P2271, P2261
pGEM®-3Z Vector
Intended for use as a standard cloning vector or for high-fidelity efficient synthesis of RNA in vitro.
P2151
pGEM®-4Z Vector
Use as a standard cloning vector, as well as for the highly efficient synthesis of RNA in vitro.
P2161
pGEM-5Zf(+) Vector
A standard cloning vector used as a template for in vitro transcription or for production of circular ssDNA.
P2241
pGEM-7Zf(+) Vector
Standard cloning vector used as a template for in vitro transcription or production of circular ssDNA.
P2251